1. HOME
  2. Model

Models

monad ID
Sequence
Length
Target
Structure String
Secondary Structure
Tertiary Structure
monad0015
CAGGCUACGCGUAGAGCAUCAUGAUCCUG
29
PDGF-B(P01127)
....(((....)))...............
Model Na+ Opt. Model Mod. Model
(((((((....)))...........))))
Model Na+ Opt. Model Mod. Model
(((((((....)))....(....).))))
Model Na+ Opt. Model Mod. Model
(((((((....)))...((....))))))
Model Na+ Opt. Model Mod. Model
((((.....................))))
Model Na+ Opt. Model Mod. Model
((((....((.....))........))))
Model Na+ Opt. Model Mod. Model
((((.(.(((.....))(...))).))))
Model Na+ Opt. Model Mod. Model
monad0024
CGGAAUCAGUGAAUGCUUAUACAUCCG
27
VEGF(P15692)
((((...................))))
Model Na+ Opt. Model Mod. Model
((((...(((....)))......))))
Model Na+ Opt. Model Mod. Model
((((((.(((....))).))...))))
Model Na+ Opt. Model Mod. Model
((((....(......).......))))
Model Na+ Opt. Model Mod. Model
((((....((((....))))...))))
Model Na+ Opt. Model Mod. Model
monad0036
CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCG
38
C5(P01031)
.........(((((((.....)))))))..........
Model Na+ Opt. Model Mod. Model
...(((((((((((((.....)))))))...))).)))
Model Na+ Opt. Model Mod. Model
.......(.(((((((.....)))))))....).....
Model Na+ Opt. Model Mod. Model
monad0045
GGGUCCUGCUGCGUAGUUUCCGUCUGCGUGGCUGUUACCC
40
NGF(P01138)
((((.(.(((((((((.......))))))))).)..))))
Model Na+ Opt. Model Mod. Model
((((.(.((((((((((....).))))))))).)..))))
Model Na+ Opt. Model Mod. Model
((((...(((((((((.......)))))))))....))))
Model Na+ Opt. Model Mod. Model
.((....(((((((((.......))))))))).....)).
Model Na+ Opt. Model Mod. Model
(((....(((((((((.......))))))))).....)))
Model Na+ Opt. Model Mod. Model
monad0049
AAUGAGUGGUUUAUUCGUU
19
Midkine(P21741)
.((((((.....)))))).
Model Na+ Opt. Model Mod. Model
(((((((.....)))))))
Model Na+ Opt. Model Mod. Model
((((((((...))))))))
Model Na+ Opt. Model Mod. Model
.(((((((...))))))).
Model Na+ Opt. Model Mod. Model
monad0052
GGCGUAGGAUGCUUCGGCAGAAGGACACGCC
31
Flavin mononucleotide
(((((.(..(.((((....)))).)))))))
Model Na+ Opt. Model Mod. Model
(((((.(....((((....))))..))))))
Model Na+ Opt. Model Mod. Model
(((((....(((....))).......)))))
Model Na+ Opt. Model Mod. Model
monad0055
GGGAAGGGAAGAAACUGCGGCUUCGGCCGGCUUCCC
36
ATP
(((((...........((((....)))).))))))
Model Na+ Opt. Model Mod. Model
.....((((((......((((....)))).))))))
Model Na+ Opt. Model Mod. Model
.....((((((...(..((((....)))))))))))
Model Na+ Opt. Model Mod. Model
monad0056
GGCUGGACUCGUACUUCGGUACUGGAGAAACAGCC
35
HIV-1 Rev peptide
(((((..(((((((....))))..)))...)))))
Model Na+ Opt. Model Mod. Model
.((((..((.((((....))))...))...)))).
Model Na+ Opt. Model Mod. Model
.((((.....((((....))))........)))).
Model Na+ Opt. Model Mod. Model
(((((.....((((....))))........)))))
Model Na+ Opt. Model Mod. Model
(((((......((......)).........)))))
Model Na+ Opt. Model Mod. Model
monad0057
GGACUGGGCGAGAAGUUUAGUCC
23
Neomycin B
(((((((((.....)))))))))
Model Na+ Opt. Model Mod. Model
.((((((((.....)))))))).
Model Na+ Opt. Model Mod. Model
.((((.(((.....))).)))).
Model Na+ Opt. Model Mod. Model
.(((...............))).
Model Na+ Opt. Model Mod. Model
monad0058
GGGCGCCGGUACGCAAGUACGACGGUACGCUCC
33
HTLV-1 Rex peptide
((((((((((((....))))..)))..))))).
Model Na+ Opt. Model Mod. Model
.(((.(((((((....))))..)))...)))..
Model Na+ Opt. Model Mod. Model
..((.(((((((....))))..)))...))...
Model Na+ Opt. Model Mod. Model
...(.((.((((....))))...))...)....
Model Na+ Opt. Model Mod. Model
......(...((....)).....).........
Model Na+ Opt. Model Mod. Model
((((.(((((((....))))..)))...)))).
Model Na+ Opt. Model Mod. Model
..((.((.((((....))))...))...))...
Model Na+ Opt. Model Mod. Model
.....(((.(((....)))...)))........
Model Na+ Opt. Model Mod. Model
monad0059
GGGAGCUUGAUCCCGGAAACGGUCGAUCGCUCCC
34
HIV-1 Tat protein(Q76PP9)
((((((..(((((((....)))..))))))))))
Model Na+ Opt. Model Mod. Model
.(((((......(((....)))......))))).
Model Na+ Opt. Model Mod. Model
.((((........((....))........)))).
Model Na+ Opt. Model Mod. Model
((((((......(((....)))......))))))
Model Na+ Opt. Model Mod. Model
((((((...((((((....)))..))).))))))
Model Na+ Opt. Model Mod. Model
((((((......................))))))
Model Na+ Opt. Model Mod. Model
monad0060
CGAAACAUAGAUUCGA
16
eIF-4A(P60842)
((((.......)))).
Model Na+ Opt. Model Mod. Model
((((.(...).)))).
Model Na+ Opt. Model Mod. Model
.(((.......)))..
Model Na+ Opt. Model Mod. Model
(((.........))).
Model Na+ Opt. Model Mod. Model
monad0061
GGAGAUCGCACUCCA
15
eIF-4A(P60842)
((((......)))).
Model Na+ Opt. Model Mod. Model
((((.(...))))).
Model Na+ Opt. Model Mod. Model
.((........))..
Model Na+ Opt. Model Mod. Model
monad0062
GGGACGAAGUGGUUGGGCGCUUCGGCGUGUGAAAACGUCCC
41
GTP
((((((...(..(((.((((....)))).)))..)))))))
Model Na+ Opt. Model Mod. Model
(((((((((((......))))))...((......)))))))
Model Na+ Opt. Model Mod. Model
((((((......(((.((((....)))).)))...))))))
Model Na+ Opt. Model Mod. Model
(((((.......(((.((((....)))).)))....)))))
Model Na+ Opt. Model Mod. Model
(((((((((((......)))))).............)))))
Model Na+ Opt. Model Mod. Model
monad0063
GGCAGCCACAAGAGCACGUAUACGCAAGGCUGUC
34
GTP
((((((.((........))...(....)))))))
Model Na+ Opt. Model Mod. Model
((((((.((..(....)))...(....)))))))
Model Na+ Opt. Model Mod. Model
(((((((......((........))..)))))))
Model Na+ Opt. Model Mod. Model
(((((((......(..((....)))..)))))))
Model Na+ Opt. Model Mod. Model
monad0064
GGAGGAGGAGGA
12
Bovine prion(P10279)
............
Model Na+ Opt. Model Mod. Model
monad0065
GAUACUUGAAACUGUAAGGUUGGCGUAUC
29
NF-kappaB(P19838)
(((((....((((....))))...)))))
Model Na+ Opt. Model Mod. Model
(((((((..((((....)))))).)))))
Model Na+ Opt. Model Mod. Model
(((((.(..((((....)))).).)))))
Model Na+ Opt. Model Mod. Model
.((((......(......).....)))).
Model Na+ Opt. Model Mod. Model
(((((.....(((....)))....)))))
Model Na+ Opt. Model Mod. Model
(((((......(......).....)))))
Model Na+ Opt. Model Mod. Model
.((((...................)))).
Model Na+ Opt. Model Mod. Model
monad0066
GGGAUGCUCAGUGAUCCUUCGGGAUAUCAGGGCAUCCC
38
Ribosomal protein S8(P62241)
(((((((((....((((....))))....)))))))))
Model Na+ Opt. Model Mod. Model
(((((((((...(((((....))))..).)))))))))
Model Na+ Opt. Model Mod. Model
(((((((((..((((((....))))..)))))))))))
Model Na+ Opt. Model Mod. Model
(((((((((.(..((((....))))..).)))))))))
Model Na+ Opt. Model Mod. Model
(((((((((.((.((((....))))).).)))))))))
Model Na+ Opt. Model Mod. Model
(((((((((.....(((....))).....)))))))))
Model Na+ Opt. Model Mod. Model
(((((((((......((....))......)))))))))
Model Na+ Opt. Model Mod. Model
.((((((((......((....))......)))))))).
Model Na+ Opt. Model Mod. Model
(((((((((....((((....))))....)))))))))
Model Na+ Opt. Model Mod. Model
monad0067
ACAGCACUGAUUGCGGUCGAGGUAGCUUGAUGG
33
Ribosomal protein S8(P62241)
.(.(((.....))).((((((....))))))).
Model Na+ Opt. Model Mod. Model
...(((.....))).((((((....))))))..
Model Na+ Opt. Model Mod. Model
.(.(((.....))))((((((....))))))..
Model Na+ Opt. Model Mod. Model
...............((((((....))))))..
Model Na+ Opt. Model Mod. Model
...((.......)).((((((....))))))..
Model Na+ Opt. Model Mod. Model
monad0068
CCAUACGGGAGAGAAACU
18
G Protein-coupled Receptor Kinase 2(P25098)
.....(....).......
Model Na+ Opt. Model Mod. Model
.(...(....).).....
Model Na+ Opt. Model Mod. Model
.(.(.(....))).....
Model Na+ Opt. Model Mod. Model
((....))..........
Model Na+ Opt. Model Mod. Model
((....))..(.....).
Model Na+ Opt. Model Mod. Model
((....)).((.....))
Model Na+ Opt. Model Mod. Model
.(....)...........
Model Na+ Opt. Model Mod. Model
((....))(.......).
Model Na+ Opt. Model Mod. Model
monad0069
GCACGUCCCUCACCGGUGCAAGUGAAGCCGUGGCUCUGCG
40
Chemokine CC2(P13500)
(((.(.....((.((((.........))))))...)))).
Model Na+ Opt. Model Mod. Model
.((((....((((........))))...))))........
Model Na+ Opt. Model Mod. Model
monad0072
GAUCCUGAAACUGUUUUAAGGUUGGCCGAUC
31
NF-kappaB(P19838)
((((....((((.......))))....))))
Model Na+ Opt. Model Mod. Model
((((((..((((.......))))))..))))
Model Na+ Opt. Model Mod. Model
((((((..((((.(....)))))))..))))
Model Na+ Opt. Model Mod. Model
((((((..((((.(...).))))))..))))
Model Na+ Opt. Model Mod. Model
monad1001
GGCUUUCGGGCUUUCAACAUCAGCCCCUCAGCC
33
PC-3
((((...(((((.........)))))...))))
Model Na+ Opt. Model Mod. Model
((((...(((((.(....)..)))))...))))
Model Na+ Opt. Model Mod. Model
monad1002
GGGGAGGCUGUGGUUGAGGG
20
Cells presenting IL-6R(P08887)
.......(....).......
Model Na+ Opt. Model Mod. Model
.....(((....))).....
Model Na+ Opt. Model Mod. Model
.......((........)).
Model Na+ Opt. Model Mod. Model
.((....)).(.....)...
Model Na+ Opt. Model Mod. Model
monad1003
GGCGAACAGGGGACGAGCAAGACGCC
26
Ricin A-chain (RTA)(P02879)
((((....(........)....))))
Model Na+ Opt. Model Mod. Model
((((..(.(........)..).))))
Model Na+ Opt. Model Mod. Model
((((....(....)........))))
Model Na+ Opt. Model Mod. Model
((((..(.(....)..).....))))
Model Na+ Opt. Model Mod. Model
monad1004
GGCAGACCAUACGGGAGAGAAACUUGCC
28
G protein-coupled receptor kinase 2 (P25098)
(((((.((....)).........)))))
Model Na+ Opt. Model Mod. Model
(((((.((....))..(.....))))))
Model Na+ Opt. Model Mod. Model
(((((......(....)......)))))
Model Na+ Opt. Model Mod. Model
(((((....(.(....).)....)))))
Model Na+ Opt. Model Mod. Model
(((((....(.(....))(...))))))
Model Na+ Opt. Model Mod. Model
monad1005
GGAAGAGAUGGCGACUAAAACGACUUGUCGC
31
cAMP
..........(((((.(.......).)))))
Model Na+ Opt. Model Mod. Model
(.......).(((((.(.......).)))))
Model Na+ Opt. Model Mod. Model
(.......).(((((...((....)))))))
Model Na+ Opt. Model Mod. Model
monad1006
GGCACGUGUAUUACCCUAGUGGUCGACGUGCC
32
Xanthine
(((((((..(((((....)))))..)))))))
Model Na+ Opt. Model Mod. Model
((((((((.(((((....)))))).)))))))
Model Na+ Opt. Model Mod. Model
monad1007
GGUCUUACGUCGUUCGACUAUUGGGAGACC
30
L-Isoleucine
((((((..(((....)))......))))))
Model Na+ Opt. Model Mod. Model
((((((.((((....)))....).))))))
Model Na+ Opt. Model Mod. Model
.(((...........)))....((....))
Model Na+ Opt. Model Mod. Model
((((....(.....)))))...((....))
Model Na+ Opt. Model Mod. Model
monad1008
UUACCACGCGCUCUUAACUGCUAGCGCCAUGGC
33
Moloney Murine Leukemia Virus (M-MLV) RT(Q83371)
...(((.(((((..........)))))..))).
Model Na+ Opt. Model Mod. Model
...(((.(((((..(....)..)))))..))).
Model Na+ Opt. Model Mod. Model
....(..(((((..........)))))...)..
Model Na+ Opt. Model Mod. Model
...(((.((((((......)..)))))..))).
Model Na+ Opt. Model Mod. Model
monad1009
GGUGAAGGCAACGUAUAGGCAAGCACACUUCACC
34
Basic Fibroblast Growth Factor (bFGF) (P09038)
((((((((...(((....))..))...)))))))
Model Na+ Opt. Model Mod. Model
(((((((....)................))))))
Model Na+ Opt. Model Mod. Model
(((((((....)(..........)....))))))
Model Na+ Opt. Model Mod. Model
(((((((....)((.(....).))....))))))
Model Na+ Opt. Model Mod. Model
(((((((((...((....))..))...)))))))
Model Na+ Opt. Model Mod. Model
monad1010
AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC
34
Axl tyrosine kinase receptor (P30530)
..........(((((..........)))))....
Model Na+ Opt. Model Mod. Model
..((....).(((((....(....)))))).)..
Model Na+ Opt. Model Mod. Model
..((....))(((((..........)))))....
Model Na+ Opt. Model Mod. Model
..((....))(((((..(.....).)))))....
Model Na+ Opt. Model Mod. Model
monad1011
UUGCUUGGAAUGCGUUAUAGUCUCUUAGGUGUGUA
35
SP6 RNA Polymerase
..((((.((..((......)).))..)))).....
Model Na+ Opt. Model Mod. Model
..(((((((..((......)).)).))))).....
Model Na+ Opt. Model Mod. Model
..((((....................)))).....
Model Na+ Opt. Model Mod. Model
..((((.....((......)).....)))).....
Model Na+ Opt. Model Mod. Model
monad1012
CCGGUGCGCAUAACCACCUCAGUGCGAGCAAGGAA
35
Cyanocobalamin
......(((((..........))))).........
Model Na+ Opt. Model Mod. Model
((.((.(((((..........))))).))..))..
Model Na+ Opt. Model Mod. Model
((.((.(((((.(.....)..))))).))..))..
Model Na+ Opt. Model Mod. Model
.(((((........)))).............)...
Model Na+ Opt. Model Mod. Model
((((((........))))...((....))..))..
Model Na+ Opt. Model Mod. Model
((((((........))))(..((....)).)))..
Model Na+ Opt. Model Mod. Model
monad1013
GGUGAUACCGCCCAAGAGUUCAUAUCGACGGCGGUGU
37
E. Coli 5S RNA
....((((((((...((.......))...))))))))
Model Na+ Opt. Model Mod. Model
....((((((((...((.(....)))...))))))))
Model Na+ Opt. Model Mod. Model
.......(((((.................)))))...
Model Na+ Opt. Model
monad1014
UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC
37
Alpha-V Beta-3(P06756)
((((......))))((((((....)))).(....)))
Model Na+ Opt. Model Mod. Model
.......((....)).((((....))))((....)).
Model Na+ Opt. Model Mod. Model
.....(((((((.........))).))))........
Model Na+ Opt. Model Mod. Model
.....(((((((((....)).))).))))(....)..
Model Na+ Opt. Model Mod. Model
monad1015
ACGAAGCUUGAUCCCGUUUGCCGGUCGAUCGCUUCGA
37
HIV-1 Tat protein(Q76PP9)
.((((((..(((((((.....)))..)))))))))).
Model Na+ Opt. Model Mod. Model
.((((((.......(.......).......)))))).
Model Na+ Opt. Model Mod. Model
monad1016
GGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCC
38
Malachite Green
((((((...(((((....))))).........))))))
Model Na+ Opt. Model Mod. Model
((((((((.(((((....)))))....))...))))))
Model Na+ Opt. Model Mod. Model
((((((((((((((....))))).)..))...))))))
Model Na+ Opt. Model Mod. Model
(((((((..(((((....)))))(...))...))))))
Model Na+ Opt. Model Mod. Model
monad1017
AGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACU
38
Theophylline
.(((...((.(((((.....)))))....))...))).
Model Na+ Opt. Model Mod. Model
((((...((((((((.....)))))...)))...))))
Model Na+ Opt. Model Mod. Model
((((.(.(((((((((...))))))...))).).))))
Model Na+ Opt. Model Mod. Model
.(((.......(((.......)))..........))).
Model Na+ Opt. Model Mod. Model
monad1018
GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAUCAACCC
40
ATP
(((((((..........((((((....)))))))))))))
Model Na+ Opt. Model Mod. Model
(((((((.......).(((((((....)))))))))))))
Model Na+ Opt. Model Mod. Model
monad1019
GGCAUCGGAAAGUGGGUUGAUGUAAGUAACAGGCGAUGCC
40
L-Histidine
(((((((....((....((.......))))...)))))))
Model Na+ Opt. Model Mod. Model
(((((((....((....((.(....)))))...)))))))
Model Na+ Opt. Model Mod. Model
(((((((..............((.....))...)))))))
Model Na+ Opt. Model Mod. Model
(((((((..((.....))..(((.....)))..)))))))
Model Na+ Opt. Model Mod. Model
(((((((....((...............))...)))))))
Model Na+ Opt. Model Mod. Model
(((((((....((...((.....))...))...)))))))
Model Na+ Opt. Model Mod. Model
(((((((....((.(.(((...))).).))...)))))))
Model Na+ Opt. Model Mod. Model
monad1020
GGAGACAUCCCUCUUGUUGGUGGUGCCGUGUGGAUGUCUC
40
HIV-1 Nucleocapsid
.(((((((((.....((.......)).....)))))))))
Model Na+ Opt. Model Mod. Model
.((((((((((.(..((.......)).).).)))))))))
Model Na+ Opt. Model Mod. Model
.((((((((((......((((...)))).).)))))))))
Model Na+ Opt. Model Mod. Model
.((((((((((....(.((((...)))))).)))))))))
Model Na+ Opt. Model Mod. Model
monad1021
GGAGGUGCUCCGAAAGGAACUCC
23
hlgG-Fc
((((....(((....))).))))
Model Na+ Opt. Model Mod. Model
((((.(..(((....))))))))
Model Na+ Opt. Model Mod. Model
(((......((....))...)))
Model Na+ Opt. Model Mod. Model
monad1022
AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU
34
ErbB2 in Breast Cancer Cells (P04626)
(((((((....(..........)....)))))))
Model Na+ Opt. Model Mod. Model
(((((((....((....)....)....)))))))
Model Na+ Opt. Model Mod. Model
(((((((...(.(....)....)....)))))))
Model Na+ Opt. Model Mod. Model
monad1023
GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC
35
Interleukin-8 (CXCL-8)(P10145)
...((.(((((((..((.....))..)))))))))
Model Na+ Opt. Model Mod. Model
...((.(((((((..(((...)))..)))))))))
Model Na+ Opt. Model Mod. Model
......(((((((..(.......)..)))))))..
Model Na+ Opt. Model Mod. Model
monad1024
CGAUGCGGUCUCAUGCGUCGAGUGUGAGUUUACCUUCG
38
Human complement C5 component (C5a) (P01031)
(((......(((((((.....))))))).......)))
Model Na+ Opt. Model Mod. Model
(((...((((((((((.....)))))))...))).)))
Model Na+ Opt. Model Mod. Model
(((.(.((((((((((.....)))))))...)))))))
Model Na+ Opt. Model Mod. Model
monad1025
GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC
39
EGFR - Extracellular Domain (P00533)
((((.............(..(((((...))))).)))))
Model Na+ Opt. Model Mod. Model
((((((((.....))).(..(((((...)))))))))))
Model Na+ Opt. Model Mod. Model
(((((.(.......)......((((...))))..)))))
Model Na+ Opt. Model Mod. Model
.............(((((..(((((...))))).)))))
Model Na+ Opt. Model Mod. Model
........(...)(((((..(((((...))))).)))))
Model Na+ Opt. Model Mod. Model
(((..((((...))))((..(((((...))))).)))))
Model Na+ Opt. Model Mod. Model
monad1026
CGGCCACAGAAUGAAAAACCUCAUCGAUGUUGCAUAGUUG
40
Human Osteopontin (P10451)
..((.(((..((((......))))...))).)).......
Model Na+ Opt. Model Mod. Model
..((.((((.((((......)))))..))).)).......
Model Na+ Opt. Model Mod. Model
..((.(((..((....)......)...))).)).......
Model Na+ Opt. Model Mod. Model
((((.((((.((((......)))))..))).)).....))
Model Na+ Opt. Model Mod. Model
monad1027
GGCAGGUUUGGUAUUAACACGUUAAGUCGUGG
32
Interleukin 6 (IL-6)(P05231) cytokine (P05231)
......((.......))((((......)))).
Model Na+ Opt. Model Mod. Model
.(((....).)).....((((......)))).
Model Na+ Opt. Model Mod. Model
(.((....)).).....((((......)))).
Model Mod. Model
monad1030
UGCCCUGCCCUCACCCGUUAGCCUGAGCGCCCCGCA
36
Human matrix metalloprotease 9 (hMMP-9) (P14780)
......((.((((..........)))).))......
Model Na+ Opt. Model Mod. Model
(((...((.((((..(....)..)))).))...)))
Model Na+ Opt. Model Mod. Model
.((...((.((((..........)))).))...)).
Model Na+ Opt. Model Mod. Model
monad1033
GGUCUUACGUCGUUCGCGACUAUUGGGAGACC
32
L-Isoleucine
((((((..((((....))))......))))))
Model Na+ Opt. Model Mod. Model
((((((.(((((....))))....).))))))
Model Na+ Opt. Model Mod. Model
........((((....))))....((....))
Model Na+ Opt. Model Mod. Model
(((((....((......))........)))))
Model Na+ Opt. Model Mod. Model
monad1035
UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU
35
luteinizing hormone(P01215)
...((((((((((..........))))))))))..
Model Na+ Opt. Model Mod. Model
...((((((((((.(......).))))))))))..
Model Na+ Opt. Model Mod. Model
.(.((((((((((.((...).).)))))))))).)
Model Na+ Opt. Model Mod. Model