1. HOME
  2. Model

Models

monad ID
Sequence
Length
Target
Structure String
Secondary Structure
Tertiary Structure
monad0015
CAGGCUACGCGUAGAGCAUCAUGAUCCUG
29
PDGF-B(P01127)
....(((....)))...............
Model Opt. Model Mod. Model
(((((((....)))...........))))
Model Opt. Model Mod. Model
(((((((....)))....(....).))))
Model Opt. Model Mod. Model
(((((((....)))...((....))))))
Model Opt. Model Mod. Model
((((.....................))))
Model Opt. Model Mod. Model
((((....((.....))........))))
Model Opt. Model Mod. Model
((((.(.(((.....))(...))).))))
Model Opt. Model Mod. Model
monad0024
CGGAAUCAGUGAAUGCUUAUACAUCCG
27
VEGF(P15692)
((((...................))))
Model Opt. Model Mod. Model
((((...(((....)))......))))
Model Opt. Model Mod. Model
((((((.(((....))).))...))))
Model Opt. Model Mod. Model
((((....(......).......))))
Model Opt. Model Mod. Model
((((....((((....))))...))))
Model Opt. Model Mod. Model
monad0036
CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCG
38
C5(P01031)
.........(((((((.....)))))))..........
Model Opt. Model Mod. Model
...(((((((((((((.....)))))))...))).)))
Model Opt. Model Mod. Model
.......(.(((((((.....)))))))....).....
Model Opt. Model Mod. Model
monad0045
GGGUCCUGCUGCGUAGUUUCCGUCUGCGUGGCUGUUACCC
40
NGF(P01138)
((((.(.(((((((((.......))))))))).)..))))
Model Opt. Model Mod. Model
((((.(.((((((((((....).))))))))).)..))))
Model Opt. Model Mod. Model
((((...(((((((((.......)))))))))....))))
Model Opt. Model Mod. Model
.((....(((((((((.......))))))))).....)).
Model Opt. Model Mod. Model
(((....(((((((((.......))))))))).....)))
Model Opt. Model Mod. Model
monad0049
AAUGAGUGGUUUAUUCGUU
19
Midkine(P21741)
.((((((.....)))))).
Model Opt. Model Mod. Model
(((((((.....)))))))
Model Opt. Model Mod. Model
((((((((...))))))))
Model Opt. Model Mod. Model
.(((((((...))))))).
Model Opt. Model Mod. Model
monad0052
GGCGUAGGAUGCUUCGGCAGAAGGACACGCC
31
Flavin mononucleotide
(((((.(..(.((((....)))).)))))))
Model Opt. Model Mod. Model
(((((.(....((((....))))..))))))
Model Opt. Model Mod. Model
(((((....(((....))).......)))))
Model Opt. Model Mod. Model
monad0055
GGGAAGGGAAGAAACUGCGGCUUCGGCCGGCUUCCC
36
ATP
.....((((((...(..((((....)))))))))))
Model Opt. Model Mod. Model
.....((((((......((((....)))).))))))
Model Opt. Model Mod. Model
Model Opt. Model Mod. Model
monad0056
GGCUGGACUCGUACUUCGGUACUGGAGAAACAGCC
35
HIV-1 Rev peptide
(((((..(((((((....))))..)))...)))))
Model Opt. Model Mod. Model
.((((..((.((((....))))...))...)))).
Model Opt. Model Mod. Model
.((((.....((((....))))........)))).
Model Opt. Model Mod. Model
(((((.....((((....))))........)))))
Model Opt. Model Mod. Model
(((((......((......)).........)))))
Model Opt. Model Mod. Model
monad0057
GGACUGGGCGAGAAGUUUAGUCC
23
Neomycin B
(((((((((.....)))))))))
Model Opt. Model Mod. Model
.((((((((.....)))))))).
Model Opt. Model Mod. Model
.((((.(((.....))).)))).
Model Opt. Model Mod. Model
.(((...............))).
Model Opt. Model Mod. Model
monad0058
GGGCGCCGGUACGCAAGUACGACGGUACGCUCC
33
HTLV-1 Rex peptide
((((((((((((....))))..)))..))))).
Model Opt. Model Mod. Model
.(((.(((((((....))))..)))...)))..
Model Opt. Model Mod. Model
..((.(((((((....))))..)))...))...
Model Opt. Model Mod. Model
...(.((.((((....))))...))...)....
Model Opt. Model Mod. Model
......(...((....)).....).........
Model Opt. Model Mod. Model
((((.(((((((....))))..)))...)))).
Model Opt. Model Mod. Model
..((.((.((((....))))...))...))...
Model Opt. Model Mod. Model
.....(((.(((....)))...)))........
Model Opt. Model Mod. Model
monad0059
GGGAGCUUGAUCCCGGAAACGGUCGAUCGCUCCC
34
HIV-1 Tat protein(Q76PP9)
((((((..(((((((....)))..))))))))))
Model Opt. Model Mod. Model
.(((((......(((....)))......))))).
Model Opt. Model Mod. Model
.((((........((....))........)))).
Model Opt. Model Mod. Model
((((((......(((....)))......))))))
Model Opt. Model Mod. Model
((((((...((((((....)))..))).))))))
Model Opt. Model Mod. Model
((((((......................))))))
Model Opt. Model Mod. Model
monad0060
CGAAACAUAGAUUCGA
16
eIF-4A(P60842)
((((.......)))).
Model Opt. Model Mod. Model
((((.(...).)))).
Model Opt. Model Mod. Model
.(((.......)))..
Model Opt. Model Mod. Model
(((.........))).
Model Opt. Model Mod. Model
monad0061
GGAGAUCGCACUCCA
15
eIF-4A(P60842)
((((......)))).
Model Opt. Model Mod. Model
((((.(...))))).
Model Opt. Model Mod. Model
.((........))..
Model Opt. Model Mod. Model
monad0062
GGGACGAAGUGGUUGGGCGCUUCGGCGUGUGAAAACGUCCC
41
GTP
((((((...(..(((.((((....)))).)))..)))))))
Model Opt. Model Mod. Model
(((((((((((......))))))...((......)))))))
Model Opt. Model Mod. Model
((((((......(((.((((....)))).)))...))))))
Model Opt. Model Mod. Model
(((((.......(((.((((....)))).)))....)))))
Model Opt. Model Mod. Model
(((((((((((......)))))).............)))))
Model Opt. Model Mod. Model
monad0063
GGCAGCCACAAGAGCACGUAUACGCAAGGCUGUC
34
GTP
((((((.((........))...(....)))))))
Model Opt. Model Mod. Model
((((((.((..(....)))...(....)))))))
Model Opt. Model Mod. Model
(((((((......((........))..)))))))
Model Opt. Model Mod. Model
(((((((......(..((....)))..)))))))
Model Opt. Model Mod. Model
monad0065
GAUACUUGAAACUGUAAGGUUGGCGUAUC
29
NF-kappaB(P19838)
(((((....((((....))))...)))))
Model Opt. Model Mod. Model
(((((((..((((....)))))).)))))
Model Opt. Model Mod. Model
(((((.(..((((....)))).).)))))
Model Opt. Model Mod. Model
.((((......(......).....)))).
Model Opt. Model Mod. Model
(((((.....(((....)))....)))))
Model Opt. Model Mod. Model
(((((......(......).....)))))
Model Opt. Model Mod. Model
.((((...................)))).
Model Opt. Model Mod. Model
monad0066
GGGAUGCUCAGUGAUCCUUCGGGAUAUCAGGGCAUCCC
38
Ribosomal protein S8(P62241)
(((((((((....((((....))))....)))))))))
Model Opt. Model Mod. Model
(((((((((...(((((....))))..).)))))))))
Model Opt. Model Mod. Model
(((((((((..((((((....))))..)))))))))))
Model Opt. Model Mod. Model
(((((((((.(..((((....))))..).)))))))))
Model Opt. Model Mod. Model
(((((((((.((.((((....))))).).)))))))))
Model Opt. Model Mod. Model
(((((((((.....(((....))).....)))))))))
Model Opt. Model Mod. Model
(((((((((......((....))......)))))))))
Model Opt. Model Mod. Model
.((((((((......((....))......)))))))).
Model Opt. Model Mod. Model
(((((((((....((((....))))....)))))))))
Model Opt. Model Mod. Model
monad0067
ACAGCACUGAUUGCGGUCGAGGUAGCUUGAUGG
33
Ribosomal protein S8(P62241)
.(.(((.....))).((((((....))))))).
Model Opt. Model Mod. Model
...(((.....))).((((((....))))))..
Model Opt. Model Mod. Model
.(.(((.....))))((((((....))))))..
Model Opt. Model Mod. Model
...............((((((....))))))..
Model Opt. Model Mod. Model
...((.......)).((((((....))))))..
Model Opt. Model Mod. Model
monad0068
CCAUACGGGAGAGAAACU
18
G Protein-coupled Receptor Kinase 2(P25098)
.....(....).......
Model Opt. Model Mod. Model
.(...(....).).....
Model Opt. Model Mod. Model
.(.(.(....))).....
Model Opt. Model Mod. Model
((....))..........
Model Opt. Model Mod. Model
((....))..(.....).
Model Opt. Model Mod. Model
((....)).((.....))
Model Opt. Model Mod. Model
.(....)...........
Model Opt. Model Mod. Model
((....))(.......).
Model Opt. Model Mod. Model
monad0069
GCACGUCCCUCACCGGUGCAAGUGAAGCCGUGGCUCUGCG
40
Chemokine CC2(P13500)
(((.(.....((.((((.........))))))...)))).
Model Opt. Model Mod. Model
.((((....((((........))))...))))........
Model Opt. Model Mod. Model
monad0072
GAUCCUGAAACUGUUUUAAGGUUGGCCGAUC
31
NF-kappaB(P19838)
((((....((((.......))))....))))
Model Opt. Model Mod. Model
((((((..((((.......))))))..))))
Model Opt. Model Mod. Model
((((((..((((.(....)))))))..))))
Model Opt. Model Mod. Model
((((((..((((.(...).))))))..))))
Model Opt. Model Mod. Model
monad1001
GGCUUUCGGGCUUUCAACAUCAGCCCCUCAGCC
33
PC-3
((((...(((((.........)))))...))))
Model Opt. Model Mod. Model
((((...(((((.(....)..)))))...))))
Model Opt. Model Mod. Model
monad1002
GGGGAGGCUGUGGUUGAGGG
20
Cells presenting IL-6R(P08887)
.......(....).......
Model Opt. Model Mod. Model
.....(((....))).....
Model Opt. Model Mod. Model
.......((........)).
Model Opt. Model Mod. Model
.((....)).(.....)...
Model Opt. Model Mod. Model
monad1003
GGCGAACAGGGGACGAGCAAGACGCC
26
Ricin A-chain (RTA)(P02879)
((((....(........)....))))
Model Opt. Model Mod. Model
((((..(.(........)..).))))
Model Opt. Model Mod. Model
((((....(....)........))))
Model Opt. Model Mod. Model
((((..(.(....)..).....))))
Model Opt. Model Mod. Model
monad1004
GGCAGACCAUACGGGAGAGAAACUUGCC
28
G protein-coupled receptor kinase 2 (P25098)
(((((.((....)).........)))))
Model Opt. Model Mod. Model
(((((.((....))..(.....))))))
Model Opt. Model Mod. Model
(((((......(....)......)))))
Model Opt. Model Mod. Model
(((((....(.(....).)....)))))
Model Opt. Model Mod. Model
(((((....(.(....))(...))))))
Model Opt. Model Mod. Model
monad1005
GGAAGAGAUGGCGACUAAAACGACUUGUCGC
31
cAMP
..........(((((.(.......).)))))
Model Opt. Model Mod. Model
(.......).(((((.(.......).)))))
Model Opt. Model Mod. Model
(.......).(((((...((....)))))))
Model Opt. Model Mod. Model
monad1006
GGCACGUGUAUUACCCUAGUGGUCGACGUGCC
32
Xanthine
(((((((..(((((....)))))..)))))))
Model Opt. Model Mod. Model
((((((((.(((((....)))))).)))))))
Model Opt. Model Mod. Model
monad1007
GGUCUUACGUCGUUCGACUAUUGGGAGACC
30
L-Isoleucine
((((((..(((....)))......))))))
Model Opt. Model Mod. Model
((((((.((((....)))....).))))))
Model Opt. Model Mod. Model
.(((...........)))....((....))
Model Opt. Model Mod. Model
((((....(.....)))))...((....))
Model Opt. Model Mod. Model
monad1008
UUACCACGCGCUCUUAACUGCUAGCGCCAUGGC
33
Moloney Murine Leukemia Virus (M-MLV) RT(Q83371)
...(((.(((((..........)))))..))).
Model Opt. Model Mod. Model
...(((.(((((..(....)..)))))..))).
Model Opt. Model Mod. Model
....(..(((((..........)))))...)..
Model Opt. Model Mod. Model
...(((.((((((......)..)))))..))).
Model Opt. Model Mod. Model
monad1009
GGUGAAGGCAACGUAUAGGCAAGCACACUUCACC
34
Basic Fibroblast Growth Factor (bFGF) (P09038)
((((((((...(((....))..))...)))))))
Model Opt. Model Mod. Model
(((((((....)................))))))
Model Opt. Model Mod. Model
(((((((....)(..........)....))))))
Model Opt. Model Mod. Model
(((((((....)((.(....).))....))))))
Model Opt. Model Mod. Model
(((((((((...((....))..))...)))))))
Model Opt. Model Mod. Model
monad1010
AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC
34
Axl tyrosine kinase receptor (P30530)
..........(((((..........)))))....
Model Opt. Model Mod. Model
..((....).(((((....(....)))))).)..
Model Opt. Model Mod. Model
..((....))(((((..........)))))....
Model Opt. Model Mod. Model
..((....))(((((..(.....).)))))....
Model Opt. Model Mod. Model
monad1011
UUGCUUGGAAUGCGUUAUAGUCUCUUAGGUGUGUA
35
SP6 RNA Polymerase
..((((.((..((......)).))..)))).....
Model Opt. Model Mod. Model
..(((((((..((......)).)).))))).....
Model Opt. Model Mod. Model
..((((....................)))).....
Model Opt. Model Mod. Model
..((((.....((......)).....)))).....
Model Opt. Model Mod. Model
monad1012
CCGGUGCGCAUAACCACCUCAGUGCGAGCAAGGAA
35
Cyanocobalamin
......(((((..........))))).........
Model Opt. Model Mod. Model
((.((.(((((..........))))).))..))..
Model Opt. Model Mod. Model
((.((.(((((.(.....)..))))).))..))..
Model Opt. Model Mod. Model
.(((((........)))).............)...
Model Opt. Model Mod. Model
((((((........))))...((....))..))..
Model Opt. Model Mod. Model
((((((........))))(..((....)).)))..
Model Opt. Model Mod. Model
monad1013
GGUGAUACCGCCCAAGAGUUCAUAUCGACGGCGGUGU
37
E. Coli 5S RNA
....((((((((...((.......))...))))))))
Model Opt. Model Mod. Model
....((((((((...((.(....)))...))))))))
Model Opt. Model Mod. Model
.......(((((.................)))))...
Model Opt. Model
monad1014
UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC
37
Alpha-V Beta-3(P06756)
((((......))))((((((....)))).(....)))
Model Opt. Model Mod. Model
.......((....)).((((....))))((....)).
Model Opt. Model Mod. Model
.....(((((((.........))).))))........
Model Opt. Model Mod. Model
.....(((((((((....)).))).))))(....)..
Model Opt. Model Mod. Model
monad1015
ACGAAGCUUGAUCCCGUUUGCCGGUCGAUCGCUUCGA
37
HIV-1 Tat protein(Q76PP9)
.((((((..(((((((.....)))..)))))))))).
Model Opt. Model Mod. Model
.((((((.......(.......).......)))))).
Model Opt. Model Mod. Model
monad1016
GGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCC
38
Malachite Green
((((((...(((((....))))).........))))))
Model Opt. Model Mod. Model
((((((((.(((((....)))))....))...))))))
Model Opt. Model Mod. Model
((((((((((((((....))))).)..))...))))))
Model Opt. Model Mod. Model
(((((((..(((((....)))))(...))...))))))
Model Opt. Model Mod. Model
monad1017
AGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACU
38
Theophylline
.(((...((.(((((.....)))))....))...))).
Model Opt. Model Mod. Model
((((...((((((((.....)))))...)))...))))
Model Opt. Model Mod. Model
((((.(.(((((((((...))))))...))).).))))
Model Opt. Model Mod. Model
.(((.......(((.......)))..........))).
Model Opt. Model Mod. Model
monad1018
GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAUCAACCC
40
ATP
(((((((..........((((((....)))))))))))))
Model Opt. Model Mod. Model
(((((((.......).(((((((....)))))))))))))
Model Opt. Model Mod. Model
monad1019
GGCAUCGGAAAGUGGGUUGAUGUAAGUAACAGGCGAUGCC
40
L-Histidine
(((((((....((....((.......))))...)))))))
Model Opt. Model Mod. Model
(((((((....((....((.(....)))))...)))))))
Model Opt. Model Mod. Model
(((((((..............((.....))...)))))))
Model Opt. Model Mod. Model
(((((((..((.....))..(((.....)))..)))))))
Model Opt. Model Mod. Model
(((((((....((...............))...)))))))
Model Opt. Model Mod. Model
(((((((....((...((.....))...))...)))))))
Model Opt. Model Mod. Model
(((((((....((.(.(((...))).).))...)))))))
Model Opt. Model Mod. Model
monad1020
GGAGACAUCCCUCUUGUUGGUGGUGCCGUGUGGAUGUCUC
40
HIV-1 Nucleocapsid
.(((((((((.....((.......)).....)))))))))
Model Opt. Model Mod. Model
.((((((((((.(..((.......)).).).)))))))))
Model Opt. Model Mod. Model
.((((((((((......((((...)))).).)))))))))
Model Opt. Model Mod. Model
.((((((((((....(.((((...)))))).)))))))))
Model Opt. Model Mod. Model
monad1021
GGAGGUGCUCCGAAAGGAACUCC
23
hlgG-Fc
((((....(((....))).))))
Model Opt. Model Mod. Model
((((.(..(((....))))))))
Model Opt. Model Mod. Model
(((......((....))...)))
Model Opt. Model Mod. Model
monad1022
AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU
34
ErbB2 in Breast Cancer Cells (P04626)
(((((((....(..........)....)))))))
Model Opt. Model Mod. Model
(((((((....((....)....)....)))))))
Model Opt. Model Mod. Model
(((((((...(.(....)....)....)))))))
Model Opt. Model Mod. Model
monad1023
GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC
35
Interleukin-8 (CXCL-8)(P10145)
...((.(((((((..((.....))..)))))))))
Model Opt. Model Mod. Model
...((.(((((((..(((...)))..)))))))))
Model Opt. Model Mod. Model
......(((((((..(.......)..)))))))..
Model Opt. Model Mod. Model
monad1024
CGAUGCGGUCUCAUGCGUCGAGUGUGAGUUUACCUUCG
38
Human complement C5 component (C5a) (P01031)
(((......(((((((.....))))))).......)))
Model Opt. Model Mod. Model
(((...((((((((((.....)))))))...))).)))
Model Opt. Model Mod. Model
(((.(.((((((((((.....)))))))...)))))))
Model Opt. Model Mod. Model
monad1025
GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC
39
EGFR - Extracellular Domain (P00533)
((((.............(..(((((...))))).)))))
Model Opt. Model Mod. Model
((((((((.....))).(..(((((...)))))))))))
Model Opt. Model Mod. Model
(((((.(.......)......((((...))))..)))))
Model Opt. Model Mod. Model
.............(((((..(((((...))))).)))))
Model Opt. Model Mod. Model
........(...)(((((..(((((...))))).)))))
Model Opt. Model Mod. Model
(((..((((...))))((..(((((...))))).)))))
Model Opt. Model Mod. Model
monad1026
CGGCCACAGAAUGAAAAACCUCAUCGAUGUUGCAUAGUUG
40
Human Osteopontin (P10451)
..((.(((..((((......))))...))).)).......
Model Opt. Model Mod. Model
..((.((((.((((......)))))..))).)).......
Model Opt. Model Mod. Model
..((.(((..((....)......)...))).)).......
Model Opt. Model Mod. Model
((((.((((.((((......)))))..))).)).....))
Model Opt. Model Mod. Model
monad1027
GGCAGGUUUGGUAUUAACACGUUAAGUCGUGG
32
Interleukin 6 (IL-6)(P05231) cytokine (P05231)
......((.......))((((......)))).
Model Opt. Model Mod. Model
.(((....).)).....((((......)))).
Model Opt. Model Mod. Model
(.((....)).).....((((......)))).
Model Mod. Model
monad1030
UGCCCUGCCCUCACCCGUUAGCCUGAGCGCCCCGCA
36
Human matrix metalloprotease 9 (hMMP-9) (P14780)
......((.((((..........)))).))......
Model Opt. Model Mod. Model
(((...((.((((..(....)..)))).))...)))
Model Opt. Model Mod. Model
.((...((.((((..........)))).))...)).
Model Opt. Model Mod. Model
monad1033
GGUCUUACGUCGUUCGCGACUAUUGGGAGACC
32
L-Isoleucine
((((((..((((....))))......))))))
Model Opt. Model Mod. Model
((((((.(((((....))))....).))))))
Model Opt. Model Mod. Model
........((((....))))....((....))
Model Opt. Model Mod. Model
(((((....((......))........)))))
Model Opt. Model Mod. Model
monad1035
UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU
35
luteinizing hormone(P01215)
...((((((((((..........))))))))))..
Model Opt. Model Mod. Model
...((((((((((.(......).))))))))))..
Model Opt. Model Mod. Model
.(.((((((((((.((...).).)))))))))).)
Model Opt. Model Mod. Model