Detail of monad1024

Aptamer Detail

monad ID
monad1024
Length
38
Target Molecule
Human complement C5 component (C5a) (P01031)
Sequence
CGAUGCGGUCUCAUGCGUCGAGUGUGAGUUUACCUUCG
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1024-1

Parameter
CentroidFold: CONTRAFold 2^1
Structure String
(((......(((((((.....))))))).......)))
Flip Position
**************************************
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1024-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
(((...((((((((((.....)))))))...))).)))
Flip Position
***-*-----------*****-------****-----*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1024-3

Parameter
CentroidFold: McCaskill BL 2^7
Structure String
(((.(.((((((((((.....)))))))...)))))))
Flip Position
-----------------***------------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure