Detail of monad0063

Aptamer Detail

monad ID
monad0063
Length
34
Target Molecule
GTP
Sequence
GGCAGCCACAAGAGCACGUAUACGCAAGGCUGUC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0063-1

Parameter
CentroidFold: McCaskill(BL) 2^3
Structure String
((((((.((........))...(....)))))))
Flip Position
----------*****--------****-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0063-2

Parameter
CentroidFold: McCaskill(BL) 2^4
Structure String
((((((.((..(....)))...(....)))))))
Flip Position
---------********------****-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0063-3

Parameter
CentroidFold: McCaskill(Turner) 2^2
Structure String
(((((((......((........))..)))))))
Flip Position
-----********---******-*-****-----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0063-4

Parameter
CentroidFold: CONTRAfold 2^3
Structure String
(((((((......(..((....)))..)))))))
Flip Position
-----********------***---**-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure