Detail of monad0059

Aptamer Detail

monad ID
monad0059
Length
34
Target Molecule
HIV-1 Tat protein (Q76PP9)
Sequence
GGGAGCUUGAUCCCGGAAACGGUCGAUCGCUCCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0059-1

Parameter
CentroidFold: McCaskill(BL) 2^2
Structure String
((((((..(((((((....)))..))))))))))
Flip Position
---------------****--------*------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0059-2

Parameter
CentroidFold: McCaskill(BL) 2^-3
Structure String
.(((((......(((....)))......))))).
Flip Position
*-------*------****---------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0059-3

Parameter
CentroidFold: McCaskill(BL) 2^-5
Structure String
.((((........((....))........)))).
Flip Position
*------**-*----****--*------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0059-4

Parameter
CentroidFold: McCaskill(Turner) 2^-4
Structure String
((((((......(((....)))......))))))
Flip Position
-------***-----****-----**--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0059-5

Parameter
CentroidFold: CONTRAfold 2^-1
Structure String
((((((...((((((....)))..))).))))))
Flip Position
---------------****--------*------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0059-6

Parameter
CentroidFold: CONTRAfold 2^-3
Structure String
((((((......................))))))
Flip Position
------**********************------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure