Detail of monad1010

Aptamer Detail

monad ID
monad1010
Length
34
Target Molecule
Axl tyrosine kinase receptor (P30530)
Sequence
AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1010-1

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
..........(((((..........)))))....
Flip Position
**********----**********------****
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1010-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
..((....).(((((....(....)))))).)..
Flip Position
**********----****---***--*---****
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1010-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
..((....))(((((..........)))))....
Flip Position
**--*****--***************----****
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1010-4

Parameter
CentroidFold: McCaskill BL 2^4
Structure String
..((....))(((((..(.....).)))))....
Flip Position
**--****---------*-****-------****
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure