Detail of monad1033

Aptamer Detail

monad ID
monad1033
Length
32
Target Molecule
L-Isoleucine
Sequence
GGUCUUACGUCGUUCGCGACUAUUGGGAGACC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1033-1

Parameter
CentroidFold: CONTRAFold 2^1
Structure String
((((((..((((....))))......))))))
Flip Position
----------*-****-*--****--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1033-2

Parameter
CentroidFold: CONTRAFold 2^3
Structure String
((((((.(((((....))))....).))))))
Flip Position
-------**---****--******--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1033-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
........((((....))))....((....))
Flip Position
********----****----****--****--
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1033-4

Parameter
CentroidFold: McCaskill Turner 2^-5
Structure String
(((((....((......))........)))))
Flip Position
---******---****---*******-**---
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure