Detail of monad1009

Aptamer Detail

monad ID
monad1009
Length
34
Target Molecule
Basic Fibroblast Growth Factor (bFGF) (P09038)
Sequence
GGUGAAGGCAACGUAUAGGCAAGCACACUUCACC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1009-1

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((((((...(((....))..))...)))))))
Flip Position
------*****-**********-****-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1009-2

Parameter
CentroidFold: McCaskill BL 2^1
Structure String
(((((((....)................))))))
Flip Position
------*********************-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1009-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
(((((((....)(..........)....))))))
Flip Position
---***------********************--
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1009-4

Parameter
CentroidFold: McCaskill BL 2^7
Structure String
(((((((....)((.(....).))....))))))
Flip Position
------**********************------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1009-5

Parameter
CentroidFold: McCawskill Turner 2^2
Structure String
(((((((((...((....))..))...)))))))
Flip Position
--------------****----------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure