Detail of monad0072

Aptamer Detail

monad ID
monad0072
Length
31
Target Molecule
NF-kappaB (P19838)
Sequence
GAUCCUGAAACUGUUUUAAGGUUGGCCGAUC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0072-1

Parameter
CentroidFold: McCaskill(BL) 2^2
Structure String
((((....((((.......))))....))))
Flip Position
--------------****-----*-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0072-2

Parameter
CentroidFold: McCaskill(BL) 2^3
Structure String
((((((..((((.......))))))..))))
Flip Position
-------------*****-------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0072-3

Parameter
CentroidFold: McCaskill(BL) 2^9
Structure String
((((((..((((.(....)))))))..))))
Flip Position
--------------****-------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0072-4

Parameter
CentroidFold: McCaskill(Turmer) 2^7
Structure String
((((((..((((.(...).))))))..))))
Flip Position
--------------***--------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure