Detail of monad1027

Aptamer Detail

monad ID
monad1027
Length
32
Target Molecule
Interleukin 6 (IL-6) (P05231)
cytokine (P05231)
Sequence
GGCAGGUUUGGUAUUAACACGUUAAGUCGUGG
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1027-1

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
......((.......))((((......)))).
Flip Position
******-*********-----******----*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1027-2

Parameter
CentroidFold: McCaskill BL 2^5
Structure String
.(((....).)).....((((......)))).
Flip Position
**--****-*---****------***------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1027-3

Parameter
CentroidFold: McCaskill Turner 2^5
Structure String
(.((....)).).....((((......)))).
Flip Position
----***-----****-------****-----
Tertiary Structure
Rascal: Model
Modified Model
Secondary Structure