Detail of monad1030

Aptamer Detail

monad ID
monad1030
Length
36
Target Molecule
Human matrix metalloprotease 9 (hMMP-9) (P14780)
Sequence
UGCCCUGCCCUCACCCGUUAGCCUGAGCGCCCCGCA
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1030-1

Parameter
CentroidFold: CONTRAFold 2^1
Structure String
......((.((((..........)))).))......
Flip Position
*****-**-----**********--***********
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1030-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
(((...((.((((..(....)..)))).))...)))
Flip Position
-----**-------*--***--------*-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1030-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
.((...((.((((..........)))).))...)).
Flip Position
---------------*****----------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure