Detail of monad0015

Aptamer Detail

monad ID
monad0015
Length
29
Target Molecule
PDGF-B (P01127)
Sequence
CAGGCUACGCGUAGAGCAUCAUGAUCCUG
Adaptation Disease
subfoveal neovascular age-related macular degeneration
Product Name
Fovista
Phase
III
Remark
Fovista is a new drug expected as a remedy for neovascular age-related macular degeneration. Currently, 3 kinds of tests shown below has been initiated. ・a phase IIb randomized, double-masked, controlled trial to establish the safety and efficacy of intravitreous administration of Fovista administered in combination with Avastin compared to Avastin monotherapy in subjects with subfoveal neovascular age-related macular degeneration. ・a phase III randomized, double-masked, controlled trial to establish the safety and efficacy of intravitreous administration of Fovista (Anti PDGF-B pegylated aptamer) administered in combination with either Avastin or Eylea compared to Avastin or Eylea monotherapy in subjects with subfoveal neovascular age-related macular degeneration ・a phase III randomized, double-masked, controlled trial in order to establish the safety and effectiveness of intravitreal administration with combination of Fovista and Lucentis compared with administration of only Lucentis

Structure monad0015-1

Parameter
CentroidFold: CONTRAFold 2^1
Structure String
....(((....)))...............
Flip Position
****---****----**************
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0015-2

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
(((((((....)))...........))))
Flip Position
--------***---***********----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0015-3

Parameter
CentroidFold: CONTRAFold 2^3
Structure String
(((((((....)))....(....).))))
Flip Position
*-----******--****-****-**--*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0015-4

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
(((((((....)))...((....))))))
Flip Position
----*--****---***--****------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0015-5

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
((((.....................))))
Flip Position
---************************--
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0015-6

Parameter
CentroidFold: McCaskill BL 2^3
Structure String
((((....((.....))........))))
Flip Position
----****--*****----*****-----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0015-7

Parameter
CentroidFold: McCaskill BL 2^5
Structure String
((((.(.(((.....))(...))).))))
Flip Position
-----------***----***--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure