Detail of monad0015
Aptamer Detail
- monad ID
- monad0015
- Length
- 29
- Target Molecule
-
PDGF-B (P01127)
- Sequence
- CAGGCUACGCGUAGAGCAUCAUGAUCCUG
- Adaptation Disease
- subfoveal neovascular age-related macular degeneration
- Product Name
- Fovista
- Phase
- III
- Remark
- Fovista is a new drug expected as a remedy for neovascular age-related macular degeneration. Currently, 3 kinds of tests shown below has been initiated. ・a phase IIb randomized, double-masked, controlled trial to establish the safety and efficacy of intravitreous administration of Fovista administered in combination with Avastin compared to Avastin monotherapy in subjects with subfoveal neovascular age-related macular degeneration. ・a phase III randomized, double-masked, controlled trial to establish the safety and efficacy of intravitreous administration of Fovista (Anti PDGF-B pegylated aptamer) administered in combination with either Avastin or Eylea compared to Avastin or Eylea monotherapy in subjects with subfoveal neovascular age-related macular degeneration ・a phase III randomized, double-masked, controlled trial in order to establish the safety and effectiveness of intravitreal administration with combination of Fovista and Lucentis compared with administration of only Lucentis
Structure monad0015-1
- Parameter
- CentroidFold: CONTRAFold 2^1
- Structure String
- ....(((....)))...............
- Flip Position
- ****---****----**************
- Tertiary Structure
-
Rascal: Model
Na+
Optimized Model
Modified Model
Mg2+
Optimized Model
- Secondary Structure
-
Structure monad0015-2
- Parameter
- CentroidFold: CONTRAFold 2^2
- Structure String
- (((((((....)))...........))))
- Flip Position
- --------***---***********----
- Tertiary Structure
-
Rascal: Model
Na+
Optimized Model
Modified Model
Mg2+
Optimized Model
- Secondary Structure
-
Structure monad0015-3
- Parameter
- CentroidFold: CONTRAFold 2^3
- Structure String
- (((((((....)))....(....).))))
- Flip Position
- *-----******--****-****-**--*
- Tertiary Structure
-
Rascal: Model
Na+
Optimized Model
Modified Model
Mg2+
Optimized Model
- Secondary Structure
-
Structure monad0015-4
- Parameter
- CentroidFold: CONTRAFold 2^4
- Structure String
- (((((((....)))...((....))))))
- Flip Position
- ----*--****---***--****------
- Tertiary Structure
-
Rascal: Model
Na+
Optimized Model
Modified Model
Mg2+
Optimized Model
- Secondary Structure
-
Structure monad0015-5
- Parameter
- CentroidFold: McCaskill BL 2^2
- Structure String
- ((((.....................))))
- Flip Position
- ---************************--
- Tertiary Structure
-
Rascal: Model
Na+
Optimized Model
Modified Model
Mg2+
Optimized Model
- Secondary Structure
-
Structure monad0015-6
- Parameter
- CentroidFold: McCaskill BL 2^3
- Structure String
- ((((....((.....))........))))
- Flip Position
- ----****--*****----*****-----
- Tertiary Structure
-
Rascal: Model
Na+
Optimized Model
Modified Model
Mg2+
Optimized Model
- Secondary Structure
-
Structure monad0015-7
- Parameter
- CentroidFold: McCaskill BL 2^5
- Structure String
- ((((.(.(((.....))(...))).))))
- Flip Position
- -----------***----***--------
- Tertiary Structure
-
Rascal: Model
Na+
Optimized Model
Modified Model
Mg2+
Optimized Model
- Secondary Structure
-
