Detail of monad0067

Aptamer Detail

monad ID
monad0067
Length
33
Target Molecule
Ribosomal protein S8 (P62241)
Sequence
ACAGCACUGAUUGCGGUCGAGGUAGCUUGAUGG
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0067-1

Parameter
CentroidFold: McCaskill(BL) 2^2
Structure String
.(.(((.....))).((((((....))))))).
Flip Position
*-----****-----------****------**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0067-2

Parameter
CentroidFold: McCaskill(Turner) 2^2
Structure String
...(((.....))).((((((....))))))..
Flip Position
------****------------***-----***
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0067-3

Parameter
CentroidFold: McCaskill(Turner) 2^4
Structure String
.(.(((.....))))((((((....))))))..
Flip Position
------****----------*****--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0067-4

Parameter
CentroidFold: CONTRAfold 2^2
Structure String
...............((((((....))))))..
Flip Position
**************--------***------**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0067-5

Parameter
CentroidFold: CONTRAfold 2^3
Structure String
...((.......)).((((((....))))))..
Flip Position
***----***----*---*---***------**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure