Detail of monad1005

Aptamer Detail

monad ID
monad1005
Length
31
Target Molecule
cAMP
Sequence
GGAAGAGAUGGCGACUAAAACGACUUGUCGC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1005-1

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
..........(((((.(.......).)))))
Flip Position
**********-----*---********----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1005-2

Parameter
CentroidFold: McCaskill BL 2^5
Structure String
(.......).(((((.(.......).)))))
Flip Position
**********---*---*******-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1005-3

Parameter
CentroidFold: McCaskill BL 2^7
Structure String
(.......).(((((...((....)))))))
Flip Position
**********----****--***--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure