Detail of monad0036

Aptamer Detail

monad ID
monad0036
Length
38
Target Molecule
C5 (P01031)
Sequence
CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCG
Adaptation Disease
Age-Related Macular Degeneration
Product Name
Zimura
Phase
II/III
Remark
A Phase II / III randomized, double-masked, controlled trial has been carried out to assess the safety and efficacy of intravitreous administration of Zimura (anti-C5 aptamer), in subjects with geographic atrophy secondary to dry age-related macular degeneration (AMD).

Structure monad0036-1

Parameter
CentroidFold: CONTRAFold 2^0
Structure String
.........(((((((.....)))))))..........
Flip Position
********-------*-**--*------**********
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0036-2

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
...(((((((((((((.....)))))))...))).)))
Flip Position
****---*--------*****--------*-*------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0036-3

Parameter
CentroidFold: McCaskill BL 2^0
Structure String
.......(.(((((((.....)))))))....).....
Flip Position
*********--------****-------**********
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure