Detail of monad1006

Aptamer Detail

monad ID
monad1006
Length
32
Target Molecule
Xanthine
Sequence
GGCACGUGUAUUACCCUAGUGGUCGACGUGCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1006-1

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
(((((((..(((((....)))))..)))))))
Flip Position
-------------******-------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1006-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((((((.(((((....)))))).)))))))
Flip Position
--------------****--------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure