Detail of monad1012

Aptamer Detail

monad ID
monad1012
Length
35
Target Molecule
Cyanocobalamin
Sequence
CCGGUGCGCAUAACCACCUCAGUGCGAGCAAGGAA
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1012-1

Parameter
CentroidFold: CONTRAFold 2^1
Structure String
......(((((..........))))).........
Flip Position
******--*************-----*********
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1012-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((.((.(((((..........))))).))..))..
Flip Position
------------*********------------**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1012-3

Parameter
CentroidFold: CONTRAFold 2^6
Structure String
((.((.(((((.(.....)..))))).))..))..
Flip Position
-------------******--------------**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1012-4

Parameter
CentroidFold: McCaskill BL 2^1
Structure String
.(((((........)))).............)...
Flip Position
**----********----*****************
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1012-5

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
((((((........))))...((....))..))..
Flip Position
**-----*-***--------*---***--******
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1012-6

Parameter
CentroidFold: McCaskill BL 2^4
Structure String
((((((........))))(..((....)).)))..
Flip Position
**----********---------***-----****
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure