Detail of monad1014

Aptamer Detail

monad ID
monad1014
Length
37
Target Molecule
Alpha-V Beta-3 (P06756)
Sequence
UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1014-1

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((......))))((((((....)))).(....)))
Flip Position
***-******---*------*****------******
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1014-2

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
.......((....)).((((....))))((....)).
Flip Position
******----***--**---***-------***---*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1014-3

Parameter
CentroidFold: McCaskill Turner 2^2
Structure String
.....(((((((.........))).))))........
Flip Position
*****------***********-------********
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1014-4

Parameter
CentroidFold: McCaskill Turner 2^5
Structure String
.....(((((((((....)).))).))))(....)..
Flip Position
*****---------***--------*----*******
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure