Detail of monad1020

Aptamer Detail

monad ID
monad1020
Length
40
Target Molecule
HIV-1 Nucleocapsid
Sequence
GGAGACAUCCCUCUUGUUGGUGGUGCCGUGUGGAUGUCUC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1020-1

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
.(((((((((.....((.......)).....)))))))))
Flip Position
*-*-***--****----***-***--*************-
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1020-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
.((((((((((.(..((.......)).).).)))))))))
Flip Position
***--****-------********---*----****--**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1020-3

Parameter
CentroidFold: McCaskill Turner 2^2
Structure String
.((((((((((......((((...)))).).)))))))))
Flip Position
*-----**********-----****------******---
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1020-4

Parameter
CentroidFold: McCaskill Turner 2^9
Structure String
.((((((((((....(.((((...)))))).)))))))))
Flip Position
*------------**------***-----***--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure