Detail of monad1008

Aptamer Detail

monad ID
monad1008
Length
33
Target Molecule
Moloney Murine Leukemia Virus (M-MLV) RT (Q83371)
Sequence
UUACCACGCGCUCUUAACUGCUAGCGCCAUGGC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1008-1

Parameter
CentroidFold: CONTRAFold 2^3
Structure String
...(((.(((((..........)))))..))).
Flip Position
***--------*-****-**------------*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1008-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
...(((.(((((..(....)..)))))..))).
Flip Position
**----------********-------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1008-3

Parameter
CentroidFold: McCaskill BL 2^-2
Structure String
....(..(((((..........)))))...)..
Flip Position
*-----------**********----------*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1008-4

Parameter
CentroidFold: McCaskill BL 2^4
Structure String
...(((.((((((......)..)))))..))).
Flip Position
*-----------*-***-**-------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure