Detail of monad1026

Aptamer Detail

monad ID
monad1026
Length
40
Target Molecule
Human Osteopontin (P10451)
Sequence
CGGCCACAGAAUGAAAAACCUCAUCGAUGUUGCAUAGUUG
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1026-1

Parameter
CentroidFold: CONTRAFold 2^3
Structure String
..((.(((..((((......))))...))).)).......
Flip Position
****************************************
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1026-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
..((.((((.((((......)))))..))).)).......
Flip Position
********------******-----***************
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1026-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
..((.(((..((....)......)...))).)).......
Flip Position
*-------*******************-------******
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1026-4

Parameter
CentroidFold: McCaskill BL 2^5
Structure String
((((.((((.((((......)))))..))).)).....))
Flip Position
-**-------------***------**-----********
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure