Detail of monad1018

Aptamer Detail

monad ID
monad1018
Length
40
Target Molecule
ATP
Sequence
GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAUCAACCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1018-1

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
(((((((..........((((((....)))))))))))))
Flip Position
-------**********--------**------*------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1018-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
(((((((.......).(((((((....)))))))))))))
Flip Position
---------**----**------****-------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure