Detail of monad1015

Aptamer Detail

monad ID
monad1015
Length
37
Target Molecule
HIV-1 Tat protein (Q76PP9)
Sequence
ACGAAGCUUGAUCCCGUUUGCCGGUCGAUCGCUUCGA
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1015-1

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
.((((((..(((((((.....)))..)))))))))).
Flip Position
*-------------*--****--*------------*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1015-2

Parameter
CentroidFold: McCaskill BL 2^-2
Structure String
.((((((.......(.......).......)))))).
Flip Position
*--------****---****----***---------*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure