Detail of monad0058

Aptamer Detail

monad ID
monad0058
Length
33
Target Molecule
HTLV-1 Rex peptide
Sequence
GGGCGCCGGUACGCAAGUACGACGGUACGCUCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0058-1

Parameter
CentroidFold: McCaskill(BL) 2^2
Structure String
((((((((((((....))))..)))..))))).
Flip Position
-----------******---------*-----*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0058-2

Parameter
CentroidFold: McCaskill(BL) 2^-1
Structure String
.(((.(((((((....))))..)))...)))..
Flip Position
*-----------****-----**---**---**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0058-3

Parameter
CentroidFold: McCaskill(BL) 2^-2
Structure String
..((.(((((((....))))..)))...))...
Flip Position
*-----------****-----*---------**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0058-4

Parameter
CentroidFold: McCaskill(BL) 2^-4
Structure String
...(.((.((((....))))...))...)....
Flip Position
------------****-----*----------*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0058-5

Parameter
CentroidFold: McCaskill(BL) 2^-5
Structure String
......(...((....)).....).........
Flip Position
******------****------*--********
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0058-6

Parameter
CentroidFold: McCaskill(Turner) 2^-1
Structure String
((((.(((((((....))))..)))...)))).
Flip Position
------------****-----*----*-----*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0058-7

Parameter
CentroidFold: McCaskill(Turner) 2^-5
Structure String
..((.((.((((....))))...))...))...
Flip Position
------------****-----*----*---***
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0058-8

Parameter
CentroidFold: CONTRAfold 2^-3
Structure String
.....(((.(((....)))...)))........
Flip Position
****---------***-----*----*******
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure