Detail of monad1019

Aptamer Detail

monad ID
monad1019
Length
40
Target Molecule
L-Histidine
Sequence
GGCAUCGGAAAGUGGGUUGAUGUAAGUAACAGGCGAUGCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1019-1

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
(((((((....((....((.......))))...)))))))
Flip Position
-----***--***--*--****-**-*********-----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1019-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
(((((((....((....((.(....)))))...)))))))
Flip Position
------****************************------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1019-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
(((((((..............((.....))...)))))))
Flip Position
**-**********************************--*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1019-4

Parameter
CentroidFold: McCaskill BL 2^5
Structure String
(((((((..((.....))..(((.....)))..)))))))
Flip Position
-------*-*--****--***---**-----**-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1019-5

Parameter
CentroidFold: McCaskill Turner 2^0
Structure String
(((((((....((...............))...)))))))
Flip Position
-----******--***********-****-******----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1019-6

Parameter
CentroidFold: McCaskill Turner 2^1
Structure String
(((((((....((...((.....))...))...)))))))
Flip Position
*------------------***------------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1019-7

Parameter
CentroidFold: McCaskill Turner 2^2
Structure String
(((((((....((.(.(((...))).).))...)))))))
Flip Position
-----------------*******----------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure