Detail of monad1002

Aptamer Detail

monad ID
monad1002
Length
20
Target Molecule
Cells presenting IL-6R (P08887)
Sequence
GGGGAGGCUGUGGUUGAGGG
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1002-1

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
.......(....).......
Flip Position
*******--***--******
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1002-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
.....(((....))).....
Flip Position
*****---****---*****
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1002-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
.......((........)).
Flip Position
*******--********---
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1002-4

Parameter
CentroidFold: McCaskill Turner 2^4
Structure String
.((....)).(.....)...
Flip Position
*---***-----***--***
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure