Detail of monad1003

Aptamer Detail

monad ID
monad1003
Length
26
Target Molecule
Ricin A-chain (RTA) (P02879)
Sequence
GGCGAACAGGGGACGAGCAAGACGCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1003-1

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
((((....(........)....))))
Flip Position
----*-**----***----*------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1003-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((..(.(........)..).))))
Flip Position
-----------*****----------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1003-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
((((....(....)........))))
Flip Position
----------***-*******-----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1003-4

Parameter
CentroidFold: McCaskill BL 2^5
Structure String
((((..(.(....)..).....))))
Flip Position
---------***--*-----------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure