Detail of monad1021

Aptamer Detail

monad ID
monad1021
Length
23
Target Molecule
hlgG-Fc
Sequence
GGAGGUGCUCCGAAAGGAACUCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1021-1

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
((((....(((....))).))))
Flip Position
----****---****--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1021-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((.(..(((....))))))))
Flip Position
-----------****--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1021-3

Parameter
CentroidFold: McCaskill Turner 2^-2
Structure String
(((......((....))...)))
Flip Position
------*-----***--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure