Detail of monad1004

Aptamer Detail

monad ID
monad1004
Length
28
Target Molecule
G protein-coupled receptor kinase 2 (P25098)
Sequence
GGCAGACCAUACGGGAGAGAAACUUGCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1004-1

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
(((((.((....)).........)))))
Flip Position
--*-**--***---********-----*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1004-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
(((((.((....))..(.....))))))
Flip Position
--------****------****------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1004-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
(((((......(....)......)))))
Flip Position
------***--*****-*****------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1004-4

Parameter
CentroidFold: McCaskill BL 2^4
Structure String
(((((....(.(....).)....)))))
Flip Position
------------****------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1004-5

Parameter
CentroidFold: McCaskill BL 2^6
Structure String
(((((....(.(....))(...))))))
Flip Position
-------------***---***------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure