Detail of monad0052

Aptamer Detail

monad ID
monad0052
Length
31
Target Molecule
Flavin mononucleotide
Sequence
GGCGUAGGAUGCUUCGGCAGAAGGACACGCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0052-1

Parameter
CentroidFold: McCaskill(Turner) 2^2
Structure String
(((((.(..(.((((....)))).)))))))
Flip Position
-------**------**-*------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0052-2

Parameter
CentroidFold: CONTRAfold 2^2
Structure String
(((((.(....((((....))))..))))))
Flip Position
---------------****------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0052-3

Parameter
CentroidFold: McCaskill(BL) 2^1
Structure String
(((((....(((....))).......)))))
Flip Position
-------------***------****-----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure