Detail of monad1017

Aptamer Detail

monad ID
monad1017
Length
38
Target Molecule
Theophylline
Sequence
AGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACU
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1017-1

Parameter
CentroidFold: CONTRAFold 2^1
Structure String
.(((...((.(((((.....)))))....))...))).
Flip Position
*-**----------*******------**---****-*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1017-2

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
((((...((((((((.....)))))...)))...))))
Flip Position
*-********----******-----*************
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1017-3

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((.(.(((((((((...))))))...))).).))))
Flip Position
---------------*****----*******-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1017-4

Parameter
CentroidFold: McCaskill BL 2^-2
Structure String
.(((.......(((.......)))..........))).
Flip Position
----*--***----*******---**********---*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure