Detail of monad0057

Aptamer Detail

monad ID
monad0057
Length
23
Target Molecule
Neomycin B
Sequence
GGACUGGGCGAGAAGUUUAGUCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0057-1

Parameter
CentroidFold: McCaskill(BL) 2^2
Structure String
(((((((((.....)))))))))
Flip Position
---------*****---------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0057-2

Parameter
CentroidFold: McCaskill(BL) 2^-3
Structure String
.((((((((.....)))))))).
Flip Position
*--------*****---------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0057-3

Parameter
CentroidFold: McCaskill(BL) 2^-5
Structure String
.((((.(((.....))).)))).
Flip Position
*--------*****---------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0057-4

Parameter
CentroidFold: CONTRAfold 2^-4
Structure String
.(((...............))).
Flip Position
*---***************---*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure