Detail of monad0065

Aptamer Detail

monad ID
monad0065
Length
29
Target Molecule
NF-kappaB (P19838)
Sequence
GAUACUUGAAACUGUAAGGUUGGCGUAUC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0065-1

Parameter
CentroidFold: McCaskill(BL) 2^2
Structure String
(((((....((((....))))...)))))
Flip Position
-----***-----****-----**-----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0065-2

Parameter
CentroidFold: McCaskill(BL) 2^4
Structure String
(((((((..((((....)))))).)))))
Flip Position
-------------****------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0065-3

Parameter
CentroidFold: McCaskill(Turner) 2^2
Structure String
(((((.(..((((....)))).).)))))
Flip Position
-------------****------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0065-4

Parameter
CentroidFold: McCaskill(BL) 2^-2
Structure String
.((((......(......).....)))).
Flip Position
*------------****---***-----*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0065-5

Parameter
CentroidFold: McCaskill(Turner) 2^-3
Structure String
(((((.....(((....)))....)))))
Flip Position
*------------****------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0065-6

Parameter
CentroidFold: McCaskill(Turner) 2^-4
Structure String
(((((......(......).....)))))
Flip Position
--------***--****----**------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0065-7

Parameter
CentroidFold: McCaskill(Turner) 2^-5
Structure String
.((((...................)))).
Flip Position
*------***************-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure