Detail of monad1001

Aptamer Detail

monad ID
monad1001
Length
33
Target Molecule
PC-3
Sequence
GGCUUUCGGGCUUUCAACAUCAGCCCCUCAGCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1001-1

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
((((...(((((.........)))))...))))
Flip Position
------------*********-----***----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1001-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((...(((((.(....)..)))))...))))
Flip Position
--------------***----------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure