Detail of monad1029

Aptamer Detail

monad ID
monad1029
Length
24
Target Molecule
Vascular Permeability Factor(VPF) (P15692)
Vascular Endothelial Growth Factor (VEGF) (P15692)
Sequence
ACCCUGAUGGUAGACGCCGGGGUG
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1029-1

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((((.((.....)).)))))).
Flip Position
---------*****-*-------*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1029-2

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
((((((...((....)))))))).
Flip Position
-------**-******-------*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure