Detail of monad0056

Aptamer Detail

monad ID
monad0056
Length
35
Target Molecule
HIV-1 Rev peptide
Sequence
GGCUGGACUCGUACUUCGGUACUGGAGAAACAGCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0056-1

Parameter
CentroidFold: McCaskill(BL) 2^2
Structure String
(((((..(((((((....))))..)))...)))))
Flip Position
-------------******----*-----------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0056-2

Parameter
CentroidFold: McCaskill(BL) 2^-3
Structure String
.((((..((.((((....))))...))...)))).
Flip Position
*------------******----**----------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0056-3

Parameter
CentroidFold: McCaskill(BL) 2^-4
Structure String
.((((.....((((....))))........)))).
Flip Position
*------------******-------***-----*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0056-4

Parameter
CentroidFold: McCaskill(Turner) 2^-5
Structure String
(((((.....((((....))))........)))))
Flip Position
-----****-----***-----******-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0056-5

Parameter
CentroidFold: CONTRAfold 2^-2
Structure String
(((((......((......)).........)))))
Flip Position
----------*--*****--------****-----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure