Detail of monad1022

Aptamer Detail

monad ID
monad1022
Length
34
Target Molecule
ErbB2 in Breast Cancer Cells (P04626)
Sequence
AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1022-1

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
(((((((....(..........)....)))))))
Flip Position
------************************----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1022-2

Parameter
CentroidFold: McCaskill BL 2^6
Structure String
(((((((....((....)....)....)))))))
Flip Position
------------*--*****--------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1022-3

Parameter
CentroidFold: McCaskill Turner 2^7
Structure String
(((((((...(.(....)....)....)))))))
Flip Position
-------*------*********--*--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure