Detail of monad1011

Aptamer Detail

monad ID
monad1011
Length
35
Target Molecule
SP6 RNA Polymerase
Sequence
UUGCUUGGAAUGCGUUAUAGUCUCUUAGGUGUGUA
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1011-1

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
..((((.((..((......)).))..)))).....
Flip Position
****--------*-***-*-----***********
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1011-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
..(((((((..((......)).)).))))).....
Flip Position
*-------------**---------------****
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1011-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
..((((....................)))).....
Flip Position
************************-***-**-***
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1011-4

Parameter
CentroidFold: McCaskill Turner 2^-2
Structure String
..((((.....((......)).....)))).....
Flip Position
**---******---***----*****----*****
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure