Detail of monad1035

Aptamer Detail

monad ID
monad1035
Length
35
Target Molecule
luteinizing hormone (P01215)
Sequence
UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1035-1

Parameter
CentroidFold: CONTRAFold 2^1
Structure String
...((((((((((..........))))))))))..
Flip Position
****----------*********---------***
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1035-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
...((((((((((.(......).))))))))))..
Flip Position
***-------------****-------------**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1035-3

Parameter
CentroidFold: McCaskill Turner 2^8
Structure String
.(.((((((((((.((...).).)))))))))).)
Flip Position
*----------------**-*--------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure