Detail of monad1013

Aptamer Detail

monad ID
monad1013
Length
37
Target Molecule
E. Coli 5S RNA
Sequence
GGUGAUACCGCCCAAGAGUUCAUAUCGACGGCGGUGU
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1013-1

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
....((((((((...((.......))...))))))))
Flip Position
****--------****************---------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1013-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
....((((((((...((.(....)))...))))))))
Flip Position
****--------------******-------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1013-3

Parameter
CentroidFold: McCaskill BL 2^-4
Structure String
.......(((((.................)))))...
Flip Position
*******-----******************----***
Tertiary Structure
Rascal: Model
Optimized Model
Secondary Structure