Detail of monad0045

Aptamer Detail

monad ID
monad0045
Length
40
Target Molecule
NGF (P01138)
Sequence
GGGUCCUGCUGCGUAGUUUCCGUCUGCGUGGCUGUUACCC
Adaptation Disease
Pain
Product Name
RBM-004
Phase
PC
Remark
It is expected that this aptamer blocks pain signals transmitted to the spinal cord and brain

Structure monad0045-1

Parameter
CentroidFold: McCaskill(BL) 2^2
Structure String
((((.(.(((((((((.......))))))))).)..))))
Flip Position
----------------*******-----------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0045-2

Parameter
CentroidFold: McCaskill(BL) 2^5
Structure String
((((.(.((((((((((....).))))))))).)..))))
Flip Position
-----------------****-------------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0045-3

Parameter
CentroidFold: McCaskill(BL) 2^0
Structure String
((((...(((((((((.......)))))))))....))))
Flip Position
-----------------*****-----------*------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0045-4

Parameter
CentroidFold: McCaskill(BL) 2^-2
Structure String
.((....(((((((((.......))))))))).....)).
Flip Position
*---------------*******----------------*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0045-5

Parameter
CentroidFold: McCaskill(Tur) 2^-4
Structure String
(((....(((((((((.......))))))))).....)))
Flip Position
----------------*--***-----------*------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure