Detail of monad0066

Aptamer Detail

monad ID
monad0066
Length
38
Target Molecule
Ribosomal protein S8 (P62241)
Sequence
GGGAUGCUCAGUGAUCCUUCGGGAUAUCAGGGCAUCCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0066-1

Parameter
CentroidFold: McCaskill(BL) 2^2
Structure String
(((((((((....((((....))))....)))))))))
Flip Position
-----------------****-----------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0066-2

Parameter
CentroidFold: McCaskill(BL) 2^3
Structure String
(((((((((...(((((....))))..).)))))))))
Flip Position
------------------*****---------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0066-3

Parameter
CentroidFold: McCaskill(BL) 2^4
Structure String
(((((((((..((((((....))))..)))))))))))
Flip Position
---------*-----********---------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0066-4

Parameter
CentroidFold: McCaskill(Turner) 2^4
Structure String
(((((((((.(..((((....))))..).)))))))))
Flip Position
------------------***-----------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0066-5

Parameter
CentroidFold: McCaskill(Turner) 2^6
Structure String
(((((((((.((.((((....))))).).)))))))))
Flip Position
----------------******----*-*---------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0066-6

Parameter
CentroidFold: McCaskill(BL) 2^0
Structure String
(((((((((.....(((....))).....)))))))))
Flip Position
----------*----******----****---------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0066-7

Parameter
CentroidFold: McCaskill(BL) 2^-1
Structure String
(((((((((......((....))......)))))))))
Flip Position
--------*****----**-*-----****--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0066-8

Parameter
CentroidFold: McCaskill(BL) 2^-3
Structure String
.((((((((......((....))......)))))))).
Flip Position
------------*----*--------------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0066-9

Parameter
CentroidFold: McCaskill(Turner) 2^-3
Structure String
(((((((((....((((....))))....)))))))))
Flip Position
-------***--*---******---**--*--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure