Detail of monad1007

Aptamer Detail

monad ID
monad1007
Length
30
Target Molecule
L-Isoleucine
Sequence
GGUCUUACGUCGUUCGACUAUUGGGAGACC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1007-1

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
((((((..(((....)))......))))))
Flip Position
----------******--*****----***
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1007-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((((.((((....)))....).))))))
Flip Position
-------*---*****-----***------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1007-3

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
.(((...........)))....((....))
Flip Position
*-----********----------***---
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1007-4

Parameter
CentroidFold: McCaskill BL 2^4
Structure String
((((....(.....)))))...((....))
Flip Position
----**********----------****--
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure