Detail of monad0024

Aptamer Detail

monad ID
monad0024
Length
27
Target Molecule
VEGF (P15692)
Sequence
CGGAAUCAGUGAAUGCUUAUACAUCCG
Adaptation Disease
Wet Macular Degeneration neovascular age-related macular degeneration
Product Name
Pegaptanib
Phase
AD
Remark
Macugen is used for the treatment of angiogenic age-related macular degeneration (AMD).

Structure monad0024-1

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
((((...................))))
Flip Position
------******************---
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0024-2

Parameter
CentroidFold: CONTRAFold 2^4
Structure String
((((...(((....)))......))))
Flip Position
----------****----****-----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0024-3

Parameter
CentroidFold: CONTRAFold 2^6
Structure String
((((((.(((....))).))...))))
Flip Position
-----------***------*------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0024-4

Parameter
CentroidFold: McCaskill BL 2^2
Structure String
((((....(......).......))))
Flip Position
---------******---*-*------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0024-5

Parameter
CentroidFold: McCaskill Turner 2^2
Structure String
((((....((((....))))...))))
Flip Position
---*****-----***----****---
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure