Detail of monad0062

Aptamer Detail

monad ID
monad0062
Length
41
Target Molecule
GTP
Sequence
GGGACGAAGUGGUUGGGCGCUUCGGCGUGUGAAAACGUCCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0062-1

Parameter
CentroidFold: McCaskill(Turner) 2^2
Structure String
((((((...(..(((.((((....)))).)))..)))))))
Flip Position
------***-----------****-----------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0062-2

Parameter
CentroidFold: CONTRAfold 2^2
Structure String
(((((((((((......))))))...((......)))))))
Flip Position
------------*****------------*****-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0062-3

Parameter
CentroidFold: McCaskill(Turner) 2^1
Structure String
((((((......(((.((((....)))).)))...))))))
Flip Position
------***-*---------****--------**-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0062-4

Parameter
CentroidFold: McCaskill(Turner) 2^-1
Structure String
(((((.......(((.((((....)))).)))....)))))
Flip Position
-----*******--------****--------***------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0062-5

Parameter
CentroidFold: CONTRAfold 2^1
Structure String
(((((((((((......)))))).............)))))
Flip Position
**----------*****-----------*******----**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure