Detail of monad1016

Aptamer Detail

monad ID
monad1016
Length
38
Target Molecule
Malachite Green
Sequence
GGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1016-1

Parameter
CentroidFold: CONTRAFold 2^1
Structure String
((((((...(((((....))))).........))))))
Flip Position
------****-----**-----*********-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1016-2

Parameter
CentroidFold: CONTRAFold 2^3
Structure String
((((((((.(((((....)))))....))...))))))
Flip Position
****-----************--***---***--****
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1016-3

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((((((((((((....))))).)..))...))))))
Flip Position
-------***********************--------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1016-4

Parameter
CentroidFold: McCaskill BL 2^4
Structure String
(((((((..(((((....)))))(...))...))))))
Flip Position
--------*----****------*****-**-------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure