Detail of monad1025

Aptamer Detail

monad ID
monad1025
Length
39
Target Molecule
EGFR - Extracellular Domain (P00533)
Sequence
GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1025-1

Parameter
CentroidFold: CONTRAFold 2^3
Structure String
((((.............(..(((((...))))).)))))
Flip Position
--***********************************--
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1025-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((((((.....))).(..(((((...)))))))))))
Flip Position
----***************--**************----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1025-3

Parameter
CentroidFold: McCaskill BL 2^0
Structure String
(((((.(.......)......((((...))))..)))))
Flip Position
--------**-***-****----*******---------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1025-4

Parameter
CentroidFold: McCaskill Turner 2^1
Structure String
.............(((((..(((((...))))).)))))
Flip Position
*************-------------**-*---*-----
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1025-5

Parameter
CentroidFold: McCaskill Turner 2^2
Structure String
........(...)(((((..(((((...))))).)))))
Flip Position
***********---------------**-----------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1025-6

Parameter
CentroidFold: McCaskill Turner 2^5
Structure String
(((..((((...))))((..(((((...))))).)))))
Flip Position
*****----*------------**-**-**------***
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure