Detail of monad1023

Aptamer Detail

monad ID
monad1023
Length
35
Target Molecule
Interleukin-8 (CXCL-8) (P10145)
Sequence
GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1023-1

Parameter
CentroidFold: CONTRAFold 2^2
Structure String
...((.(((((((..((.....))..)))))))))
Flip Position
***--------------*****-------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1023-2

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
...((.(((((((..(((...)))..)))))))))
Flip Position
***-------------******-------------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad1023-3

Parameter
CentroidFold: McCaskill BL 2^0
Structure String
......(((((((..(.......)..)))))))..
Flip Position
******----------******-----------**
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure