Detail of monad0055

Aptamer Detail

monad ID
monad0055
Length
36
Target Molecule
ATP
Sequence
GGGAAGGGAAGAAACUGCGGCUUCGGCCGGCUUCCC
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0055-1

Parameter
CentroidFold: McCaskill(Turner) 2^2
Structure String
.....((((((...(..((((....)))))))))))
Flip Position
------***--******----*****----------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0055-2

Parameter
CentroidFold: CONTRAfold 2^2
Structure String
.....((((((......((((....)))).))))))
Flip Position
*****-----******----******----------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0055-3

Parameter
CentroidFold: CONTRAfold 2^3
Structure String
None
Flip Position
*****-------*****----*****----------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure