Detail of monad0069

Aptamer Detail

monad ID
monad0069
Length
40
Target Molecule
Chemokine CC2 (P13500)
Sequence
GCACGUCCCUCACCGGUGCAAGUGAAGCCGUGGCUCUGCG
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad0069-1

Parameter
CentroidFold: McCaskill(Turner) 2^2
Structure String
(((.(.....((.((((.........))))))...)))).
Flip Position
-------***------**********------***----*
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure

Structure monad0069-2

Parameter
CentroidFold: CONTRAfold 2^2
Structure String
.((((....((((........))))...))))........
Flip Position
-------------*--**-**------------*******
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure