Detail of monad1031

Aptamer Detail

monad ID
monad1031
Length
20
Target Molecule
Cancer stem cell marker epithelial cell adhesion molecule (P16422)
Sequence
GCGACUGGUUACCCGGUCGU
Adaptation Disease
Product Name
None
Phase
N/A
Remark
None

Structure monad1031-1

Parameter
CentroidFold: CONTRAFold 2^5
Structure String
((((((((....))))))))
Flip Position
---------**---------
Tertiary Structure
Rascal: Model
Optimized Model
Modified Model
Secondary Structure